|
ATCC
vaginalis ![]() Vaginalis, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vaginalis/product/ATCC Average 94 stars, based on 1 article reviews
vaginalis - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
TaKaRa
acgcttaacaacaaaaccatagaag ![]() Acgcttaacaacaaaaccatagaag, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/acgcttaacaacaaaaccatagaag/product/TaKaRa Average 93 stars, based on 1 article reviews
acgcttaacaacaaaaccatagaag - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
i script cdna synthesis kit ![]() I Script Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/i script cdna synthesis kit/product/Bio-Rad Average 99 stars, based on 1 article reviews
i script cdna synthesis kit - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Proteintech
anti tdp 43 c terminal ![]() Anti Tdp 43 C Terminal, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti tdp 43 c terminal/product/Proteintech Average 95 stars, based on 1 article reviews
anti tdp 43 c terminal - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Boster Bio
rabbit polyclonal antibodies against chop gadd153 ![]() Rabbit Polyclonal Antibodies Against Chop Gadd153, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal antibodies against chop gadd153/product/Boster Bio Average 91 stars, based on 1 article reviews
rabbit polyclonal antibodies against chop gadd153 - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
|
Chem Impex International
glycerol chem impex ![]() Glycerol Chem Impex, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/glycerol chem impex/product/Chem Impex International Average 95 stars, based on 1 article reviews
glycerol chem impex - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Boster Bio
chop ![]() Chop, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chop/product/Boster Bio Average 93 stars, based on 1 article reviews
chop - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Proteintech
antibodies against ybx2 ![]() Antibodies Against Ybx2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibodies against ybx2/product/Proteintech Average 93 stars, based on 1 article reviews
antibodies against ybx2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Chem Impex International
34860 acetonitrile acs grade ![]() 34860 Acetonitrile Acs Grade, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/34860 acetonitrile acs grade/product/Chem Impex International Average 95 stars, based on 1 article reviews
34860 acetonitrile acs grade - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
ProSci Incorporated
cancer cells 1857 anti chop ![]() Cancer Cells 1857 Anti Chop, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cancer cells 1857 anti chop/product/ProSci Incorporated Average 90 stars, based on 1 article reviews
cancer cells 1857 anti chop - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Zymo Research
unmethylated control template ![]() Unmethylated Control Template, supplied by Zymo Research, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/unmethylated control template/product/Zymo Research Average 94 stars, based on 1 article reviews
unmethylated control template - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Proteintech
homozygous mice ![]() Homozygous Mice, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/homozygous mice/product/Proteintech Average 95 stars, based on 1 article reviews
homozygous mice - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLOS ONE
Article Title: Highly sensitive molecular assay based on Identical Multi-Repeat Sequence (IMRS) algorithm for the detection of Trichomonas vaginalis infection
doi: 10.1371/journal.pone.0317958
Figure Lengend Snippet: Lower limit of detection (LLOD) for the Iso-thermal amplification was calculated using the Probit analysis (A). 2% gel image of amplicons of 100-fold serial dilution of Trichomonas vaginalis DNA template (1, 100bp ladder, 2, 10 2 pg/μl, 3, 1 pg/μl, 4, 10 −2 pg/μl, 5, 10 −4 pg/μl, 6, 10 −6 pg/μl, 7, 10 −8 pg/μl and 8, non-template control). The estimated LLOD for the Isothermal assay was 0.0201 pg/μl.
Article Snippet: Quantitative Genomic DNA from T .
Techniques: Amplification, Serial Dilution, Control
Journal: PLOS ONE
Article Title: Highly sensitive molecular assay based on Identical Multi-Repeat Sequence (IMRS) algorithm for the detection of Trichomonas vaginalis infection
doi: 10.1371/journal.pone.0317958
Figure Lengend Snippet: Lower limit of detection for Trichomonas vaginalis using IMRS primers was 0.03 fg/ μ l (A) and 18S rRNA PCR primers was 0.714pg/ μ L (B) respectively.
Article Snippet: Quantitative Genomic DNA from T .
Techniques:
Journal: Drug Design, Development and Therapy
Article Title: Tanshinone IIA Ameliorates Streptozotocin-Induced Diabetic Nephropathy, Partly by Attenuating PERK Pathway-Induced Fibrosis
doi: 10.2147/DDDT.S257734
Figure Lengend Snippet: Tan IIA down-regulates TGF-β1, TSP-1, Grp78 and CHOP expression in the renal tissues of the diabetic rats. ( A ) Immunohistochemical analysis of TGF-β1, TSP-1, Grp78 and CHOP expression in the renal tissues among five groups and the pooled data from ten sections for each group is summarized. Scale bar: 50 μm (×400). ( B, C ) The expression levels of Grp78 ( B ) and CHOP ( C ) from different treatment groups were determined by qRT-PCR. N = 10; * P <0.05 and ** P <0.01.
Article Snippet: The sections were incubated with primary antibodies against Grp78 (1:100),
Techniques: Expressing, Immunohistochemical staining, Quantitative RT-PCR
Journal: Journal of Clinical Investigation
Article Title: Methylation in pericytes after acute injury promotes chronic kidney disease
doi: 10.1172/jci135773
Figure Lengend Snippet: Figure 8. YBX2 expression in pericytes decreased after acute kidney injury. (A) Representative images showing the immunohistochemistry staining of YBX2 in the Ctrl kidneys. Arrows indicate YBX2+ interstitial cells. Scale bars: 25 μm. Original magnification, ×400. (B) Represen- tative images showing Col1a1-GFP+ qPericytes with YBX2 expression in the Ctrl kidney of Col1a1-GFPTg mice. Scale bars: 25 μm. Original magnification, ×400. (C) Representative images showing the immuno histochemistry staining of YBX2 in kidneys on day 7 after IRI-AKI. Arrowheads indicate YBX2+ tubular epithelial cells while asterisks indicate interstitial cells without YBX2. Scale bars: 25 μm. Original magnification, ×400. (D) Dot chart showing the expression of Ybx2 in the Ctrl and day 7 IRI-AKI kidneys. n = 5. (E and F) Dot chart showing the expression of Ybx2 and Acta2 in purified pericytes from the kidneys at the indicated time points after IRI-AKI. Horizontal bars represent the mean, error bars represent the SEM. n = 4. *P < 0.05, **P < 0.01, ***P < 0.001 by 1-way ANOVA with post hoc Tukey’s correction.
Article Snippet: Sections were blocked in 10% normal goat serum for 1 hour, and then incubated with the primary
Techniques: Expressing, Immunohistochemistry, Staining, Purification
Journal: Journal of Clinical Investigation
Article Title: Methylation in pericytes after acute injury promotes chronic kidney disease
doi: 10.1172/jci135773
Figure Lengend Snippet: Figure 9. YBX2 repressed the expression of Acta2. (A) Line chart showing the expression of Ybx2 mRNA in the primary kidney pericytes after TGF-β1 exposure and withdrawal at the indicated time points. Data were expressed as the mean ± SEM. n = 3. *P < 0.05 by t test vs. before TGF-β1 withdrawal. (B) Representative images showing the electrophoresis of the PCR products of the Ybx2 gene using MeDIP or input DNA from primary kidney pericytes after TGF-β1 exposure for 24 or 120 hours. Pericytes without TGF-β1 exposure served as the Ctrl. (C) Scheme showing the primer design in the promoter regions of the Acta2 gene. (D) Repre- sentative images showing the electrophoresis of PCR products of the promoter of the Acta2 gene using DNA immunoprecipitated by anti- YBX2 antibody (ChIP) or input DNA from the primary kidney pericytes with or without TGF-β1 exposure for 120 hours. ChIP using isotype IgG served as the Ctrl. (E) Representative Western blot analyses for YBX2, αSMA, and β-actin in pericytes with or without lentiviral transduction for YBX2 expression. (F) Dot chart showing the relative expression of YBX2 and αSMA in pericytes with or without lentiviral transduction for YBX2 expression. Horizontal bars represent the mean, error bars represent the SEM. n = 3. **P < 0.01, ***P < 0.001 by 1-way ANOVA with post hoc Tukey’s correction.
Article Snippet: Sections were blocked in 10% normal goat serum for 1 hour, and then incubated with the primary
Techniques: Expressing, Electrophoresis, Methylated DNA Immunoprecipitation, Immunoprecipitation, Western Blot, Transduction